Orthologous regulated operons containing STM1555 gene
| Regulog: | STM1555 - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photorhabdus luminescens subsp. laumondii TTO1 | ||||
|
Position: -167
Score: 6.90148 Sequence: TCATGAAACCGGTTACATGA
Locus tag: plu3734
Name: STM1555 Funciton: Transcriptional regulator, LacI family |
||||
| STM1555 | -167 | 6.9 | TCATGAAACCGGTTACATGA | plu3734 |