Orthologous regulated operons containing SCF41.28c gene
| Regulog: | RhaR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: -41
Score: 4.03855 Sequence: CGAGTAAAACGATTCAATCG
Locus tag: SCO0371
Name: SCF41.30c Funciton: COG3533 secreted protein
Locus tag: SCO0370
Name: SCF41.29c Funciton: Predicted alpha-L-rhamnosidase
Locus tag: SCO0369
Name: SCF41.28c Funciton: putative secreted protein |
||||
| SCF41.30c-SCF41.29c-SCF41.28c | -41 | 4 | CGAGTAAAACGATTCAATCG | SCO0371 |
| Streptomyces scabiei 87.22 | ||||
|
Position: -54
Score: 4.11198 Sequence: GTGATGAAACGTTTTAATCC
Locus tag: SCAB_86701
Name: SCF41.28c Funciton: putative secreted protein
Locus tag: SCAB_86711
Name: null Funciton: putative exported rhamnosidase A |
||||
| SCF41.28c-SCAB_86711 | -54 | 4.1 | GTGATGAAACGTTTTAATCC | SCAB_86701 |