Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SCF41.30c gene

Properties
Regulog: RhaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Phylum: Actinobacteria
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces coelicolor A3(2)
Position: -41
Score: 4.03855
Sequence: CGAGTAAAACGATTCAATCG
Locus tag: SCO0371
Name: SCF41.30c
Funciton: COG3533 secreted protein
Locus tag: SCO0370
Name: SCF41.29c
Funciton: Predicted alpha-L-rhamnosidase
Locus tag: SCO0369
Name: SCF41.28c
Funciton: putative secreted protein
SCF41.30c-SCF41.29c-SCF41.28c -41 4 CGAGTAAAACGATTCAATCG SCO0371
© 2009-2020 RegPrecise