Orthologous regulated operons containing SCF41.30c gene
Regulog: | RhaR - Streptomycetaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Rhamnose utilization |
Effector: | Rhamnose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptomyces coelicolor A3(2) | ||||
Position: -41
Score: 4.03855 Sequence: CGAGTAAAACGATTCAATCG
Locus tag: SCO0371
Name: SCF41.30c Funciton: COG3533 secreted protein
Locus tag: SCO0370
Name: SCF41.29c Funciton: Predicted alpha-L-rhamnosidase
Locus tag: SCO0369
Name: SCF41.28c Funciton: putative secreted protein |
||||
SCF41.30c-SCF41.29c-SCF41.28c | -41 | 4 | CGAGTAAAACGATTCAATCG | SCO0371 |