Orthologous regulated operons containing rhmA2 gene
| Regulog: | RhaR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: -53
Score: 4.28657 Sequence: GGATTGAATCGATTCAATCA
Locus tag: SCO0372
Name: rhmA2 Funciton: Predicted alpha-L-rhamnosidase |
||||
| rhmA2 | -53 | 4.3 | GGATTGAATCGATTCAATCA | SCO0372 |