Orthologous regulated operons containing rhmA gene
| Regulog: | RhaR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -155
Score: 4.27671 Sequence: GCTGTGAATCGATTCACCTT
Locus tag: SAV_828
Name: rhmA Funciton: rhamnosidase |
||||
| rhmA | -155 | 4.3 | GCTGTGAATCGATTCACCTT | SAV_828 |