Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SAV_6815 gene

Properties
Regulog: RhaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Phylum: Actinobacteria
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -52
Score: 4.68169
Sequence: TACTTGAAACGATTCATGAC
Locus tag: SAV_6812
Name: rhiL
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SAV_6813
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SAV_6814
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: SAV_6815
Name: SAV_6815
Funciton: hypothetical protein
rhiL-rhiF-rhiG-SAV_6815 -52 4.7 TACTTGAAACGATTCATGAC SAV_6812
Streptomyces scabiei 87.22
Position: -50
Score: 4.2288
Sequence: TACTTGAAACGATTCACGGC
Locus tag: SCAB_74641
Name: rhiL
Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SCAB_74651
Name: rhiF
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SCAB_74661
Name: rhiG
Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: SCAB_74671
Name: SAV_6815
Funciton: hypothetical protein
rhiL-rhiF-rhiG-SAV_6815 -50 4.2 TACTTGAAACGATTCACGGC SCAB_74641
© 2009-2020 RegPrecise