Orthologous regulated operons containing SAV_6815 gene
| Regulog: | RhaR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -52
Score: 4.68169 Sequence: TACTTGAAACGATTCATGAC
Locus tag: SAV_6812
Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SAV_6813
Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SAV_6814
Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: SAV_6815
Name: SAV_6815 Funciton: hypothetical protein |
||||
| rhiL-rhiF-rhiG-SAV_6815 | -52 | 4.7 | TACTTGAAACGATTCATGAC | SAV_6812 |
| Streptomyces scabiei 87.22 | ||||
|
Position: -50
Score: 4.2288 Sequence: TACTTGAAACGATTCACGGC
Locus tag: SCAB_74641
Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Locus tag: SCAB_74651
Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Locus tag: SCAB_74661
Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Locus tag: SCAB_74671
Name: SAV_6815 Funciton: hypothetical protein |
||||
| rhiL-rhiF-rhiG-SAV_6815 | -50 | 4.2 | TACTTGAAACGATTCACGGC | SCAB_74641 |