Orthologous regulated operons containing rhiL gene

Properties
Regulog:	RhaR - Streptomycetaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose utilization
Effector:	Rhamnose
Phylum:	Actinobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -52 Score: 4.68169 Sequence: TACTTGAAACGATTCATGAC Locus tag: SAV_6812 Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: SAV_6813 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: SAV_6814 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: SAV_6815 Name: SAV_6815 Funciton: hypothetical protein
rhiL-rhiF-rhiG-SAV_6815	-52	4.7	TACTTGAAACGATTCATGAC	SAV_6812
Streptomyces coelicolor A3(2)
Position: -48 Score: 4.78631 Sequence: TACTTGAAACGATTCATGAG Locus tag: SCO1539 Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: SCO1538 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: SCO1537 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2
rhiL-rhiF-rhiG	-48	4.8	TACTTGAAACGATTCATGAG	SCO1539
Streptomyces scabiei 87.22
Position: -50 Score: 4.2288 Sequence: TACTTGAAACGATTCACGGC Locus tag: SCAB_74641 Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein Locus tag: SCAB_74651 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: SCAB_74661 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: SCAB_74671 Name: SAV_6815 Funciton: hypothetical protein
rhiL-rhiF-rhiG-SAV_6815	-50	4.2	TACTTGAAACGATTCACGGC	SCAB_74641