Orthologous regulated operons containing mcp gene
Regulog: | ExuR - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galacturonate utilization |
Effector: | Galacturonate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium acetobutylicum ATCC 824 | ||||
Position: -51
Score: 5.25059 Sequence: TTTTGTTAACGTTATCTGTA
Position: -38
Score: 4.53584 Sequence: ATCTGTATACGATAACAATT
Locus tag: CAC2774
Name: mcp Funciton: Methyl-accepting chemotaxis protein with HAMP domain |
||||
mcp | -51 | 5.3 | TTTTGTTAACGTTATCTGTA | CAC2774 |
-38 | 4.5 | ATCTGTATACGATAACAATT |