Orthologous regulated operons containing pelL gene
Regulog: | ExuR - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galacturonate utilization |
Effector: | Galacturonate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium acetobutylicum ATCC 824 | ||||
Position: -167
Score: 5.66377 Sequence: GTTTGTTAACGATAACAATA
Locus tag: CAC0812
Name: pelL Funciton: Pectate transeliminase, secreted |
||||
pelL | -167 | 5.7 | GTTTGTTAACGATAACAATA | CAC0812 |