Orthologous regulated operons containing celA gene
| Regulog: | CelR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -83
Score: 6.93866 Sequence: TAACGCAACCGGTTGCGCTT
Locus tag: VC1281
Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: VC1282
Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: VC1283
Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: VC1284
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: VC1285
Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein
Locus tag: VC1286
Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family |
||||
| celB-celD-celA-bglA-celE-celR | -83 | 6.9 | TAACGCAACCGGTTGCGCTT | VC1281 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -84
Score: 6.67895 Sequence: CAATGCAACCGGTTGCGCTT
Locus tag: VIBHAR_03625
Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: VIBHAR_03624
Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: VIBHAR_03623
Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: VIBHAR_03622
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: VIBHAR_03621
Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein
Locus tag: VIBHAR_03620
Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family |
||||
| celB-celD-celA-bglA-celE-celR | -84 | 6.7 | CAATGCAACCGGTTGCGCTT | VIBHAR_03625 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -84
Score: 7.05039 Sequence: TAGCGCAACCGGTTGCGCTT
Locus tag: VP2637
Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: VP2636
Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: VP2635
Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: VP2634
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: VP2633
Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein
Locus tag: VP2632
Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family |
||||
| celB-celD-celA-bglA-celE-celR | -84 | 7.1 | TAGCGCAACCGGTTGCGCTT | VP2637 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -127
Score: 6.67895 Sequence: CAATGCAACCGGTTGCGCTT
Locus tag: VV1_1482
Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: VV1_1483
Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: VV1_1484
Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: VV1_1485
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: VV1_1486
Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein
Locus tag: VV1_1487
Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family |
||||
| celB-celD-celA-bglA-celE-celR | -127 | 6.7 | CAATGCAACCGGTTGCGCTT | VV1_1482 |