Orthologous regulated operons containing celB gene

Properties
Regulog:	CelR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -150 Score: 6.73565 Sequence: TCGCGCAACCGGTTGCGCTT Locus tag: PBPRA0495 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: PBPRA0496 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: PBPRA0497 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: PBPRA0498 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: PBPRA0499 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family Locus tag: PBPRA0500 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
celB-celD-bglA-celE-celR-celR	-150	6.7	TCGCGCAACCGGTTGCGCTT	PBPRA0495
Vibrio cholerae O1 biovar eltor str. N16961
Position: -83 Score: 6.93866 Sequence: TAACGCAACCGGTTGCGCTT Locus tag: VC1281 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VC1282 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VC1283 Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: VC1284 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: VC1285 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: VC1286 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
celB-celD-celA-bglA-celE-celR	-83	6.9	TAACGCAACCGGTTGCGCTT	VC1281
Vibrio harveyi ATCC BAA-1116
Position: -84 Score: 6.67895 Sequence: CAATGCAACCGGTTGCGCTT Locus tag: VIBHAR_03625 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VIBHAR_03624 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VIBHAR_03623 Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: VIBHAR_03622 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: VIBHAR_03621 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: VIBHAR_03620 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
celB-celD-celA-bglA-celE-celR	-84	6.7	CAATGCAACCGGTTGCGCTT	VIBHAR_03625
Vibrio parahaemolyticus RIMD 2210633
Position: -84 Score: 7.05039 Sequence: TAGCGCAACCGGTTGCGCTT Locus tag: VP2637 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VP2636 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VP2635 Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: VP2634 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: VP2633 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: VP2632 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
celB-celD-celA-bglA-celE-celR	-84	7.1	TAGCGCAACCGGTTGCGCTT	VP2637
Vibrio vulnificus CMCP6
Position: -127 Score: 6.67895 Sequence: CAATGCAACCGGTTGCGCTT Locus tag: VV1_1482 Name: celB Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VV1_1483 Name: celD Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VV1_1484 Name: celA Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) Locus tag: VV1_1485 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: VV1_1486 Name: celE Funciton: Cellobiose phosphotransferase system YdjC-like protein Locus tag: VV1_1487 Name: celR Funciton: Transcriptional regulator for cellobiose utilization, LacI family
celB-celD-celA-bglA-celE-celR	-127	6.7	CAATGCAACCGGTTGCGCTT	VV1_1482