Orthologous regulated operons containing kguA gene
Regulog: | PtxS - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | 2-ketogluconate utilization |
Effector: | 2-keto-D-gluconate |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Ralstonia eutropha H16 | ||||
Position: -79
Score: 6.24412 Sequence: TCCTGAAACCGGTTTCAAAA
Locus tag: H16_B1807
Name: kguS Funciton: Putative 2-ketogluconate ABC transporter, substrate-binding component
Locus tag: H16_B1808
Name: kguC Funciton: Putative 2-ketogluconate ABC transporter, permease component
Locus tag: H16_B1809
Name: kguB Funciton: Putative 2-ketogluconate ABC transporter, permease component
Locus tag: H16_B1810
Name: kguA Funciton: Putative 2-ketogluconate ABC transporter, ATPase component
Locus tag: H16_B1811
Name: kguE Funciton: Epimerase KguE
Locus tag: H16_B1812
Name: kguK Funciton: 2-ketogluconate kinase EC=2.7.1.13
Locus tag: H16_B1813
Name: kguD Funciton: 2-ketogluconate-6-phosphate reductase EC=1.1.1.43 |
||||
kguS-kguC-kguB-kguA-kguE-kguK-kguD | -79 | 6.2 | TCCTGAAACCGGTTTCAAAA | H16_B1807 |