Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing malR2 gene

Properties
Regulog: MalR2 - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: 91
Score: 6.19868
Sequence: TTGTGCAATCGTTTTCGCAA
Locus tag: Aflv_2191
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: Aflv_2190
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Aflv_2189
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Aflv_2188
Name: nplT2
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: Aflv_2187
Name: null
Funciton: Alpha-glucosidase (EC 3.2.1.20)
Locus tag: Aflv_2186
Name: malR2
Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
malE-malF-malG-nplT2-Aflv_2187-malR2 91 6.2 TTGTGCAATCGTTTTCGCAA Aflv_2191
Bacillus clausii KSM-K16
Position: -89
Score: 6.17098
Sequence: TTGTGCAAACGATTTCACCA
Locus tag: ABC4030
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: ABC4029
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: ABC4028
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: ABC4027
Name: malR2
Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
malE-malF-malG-malR2 -89 6.2 TTGTGCAAACGATTTCACCA ABC4030
Bacillus halodurans C-125
Position: -87
Score: 6.18357
Sequence: TTGTGCAAACGATTTCCTAA
Locus tag: BH2926
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: BH2925
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: BH2924
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: BH2923
Name: malR2
Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
malE-malF-malG-malR2 -87 6.2 TTGTGCAAACGATTTCCTAA BH2926
Geobacillus kaustophilus HTA426
Position: -101
Score: 5.33133
Sequence: TGGTGCAATCGTTTTCATAG
Position: -64
Score: 5.96442
Sequence: TTGCGCAAACGTTTTCCTTA
Locus tag: GK0704
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: GK0705
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: GK0706
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: GK0707
Name: nplT2
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: GK0708
Name: malR2
Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
malE-malF-malG-nplT2-malR2 -101 5.3 TGGTGCAATCGTTTTCATAG GK0704
-64 6 TTGCGCAAACGTTTTCCTTA