Orthologous regulated operons containing SAV_2571 gene

Properties
Regulog:	SCO5692 - Streptomycetaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Actinobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -151 Score: 6.60343 Sequence: ACATCGAAGCGCTTCGACTC Locus tag: SAV_2577 Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein Locus tag: SAV_2576 Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1 Locus tag: SAV_2575 Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2 Locus tag: SAV_2574 Name: SAV_2574 Funciton: Predicted glycosyl hydrolase Locus tag: SAV_2573 Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SAV_2572 Name: SAV_2572 Funciton: Predicted secreted protein Locus tag: SAV_2571 Name: SAV_2571 Funciton: Predicted sugar hydrolase
SAV_2577-SAV_2576-SAV_2575-SAV_2574-SAV_2573-SAV_2572-SAV_2571	-151	6.6	ACATCGAAGCGCTTCGACTC	SAV_2577
Streptomyces coelicolor A3(2)
Position: -218 Score: 6.3476 Sequence: ACGTCGAAGCGCTTCGATGC Position: -109 Score: 6.68391 Sequence: ACATCGAAGCGCTTCGACAC Locus tag: SCO5686 Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein Locus tag: SCO5687 Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1 Locus tag: SCO5688 Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2 Locus tag: SCO5689 Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SCO5690 Name: SAV_2572 Funciton: Predicted secreted protein Locus tag: SCO5691 Name: SAV_2571 Funciton: Predicted sugar hydrolase
SAV_2577-SAV_2576-SAV_2575-SAV_2573-SAV_2572-SAV_2571	-218	6.3	ACGTCGAAGCGCTTCGATGC	SCO5686
	-109	6.7	ACATCGAAGCGCTTCGACAC
Streptomyces scabiei 87.22
Position: -151 Score: 6.71373 Sequence: ACATCGAAGCGCTTCGACTG Locus tag: SCAB_25621 Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein Locus tag: SCAB_25611 Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1 Locus tag: SCAB_25601 Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2 Locus tag: SCAB_25591 Name: SAV_2574 Funciton: Predicted glycosyl hydrolase Locus tag: SCAB_25581 Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SCAB_25571 Name: SAV_2571 Funciton: Predicted sugar hydrolase
SAV_2577-SAV_2576-SAV_2575-SAV_2574-SAV_2573-SAV_2571	-151	6.7	ACATCGAAGCGCTTCGACTG	SCAB_25621