Orthologous regulated operons containing SAV_2575 gene
| Regulog: | SCO5692 - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -151
Score: 6.60343 Sequence: ACATCGAAGCGCTTCGACTC
Locus tag: SAV_2577
Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SAV_2576
Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SAV_2575
Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SAV_2574
Name: SAV_2574 Funciton: Predicted glycosyl hydrolase
Locus tag: SAV_2573
Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SAV_2572
Name: SAV_2572 Funciton: Predicted secreted protein
Locus tag: SAV_2571
Name: SAV_2571 Funciton: Predicted sugar hydrolase |
||||
| SAV_2577-SAV_2576-SAV_2575-SAV_2574-SAV_2573-SAV_2572-SAV_2571 | -151 | 6.6 | ACATCGAAGCGCTTCGACTC | SAV_2577 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -218
Score: 6.3476 Sequence: ACGTCGAAGCGCTTCGATGC
Position: -109
Score: 6.68391 Sequence: ACATCGAAGCGCTTCGACAC
Locus tag: SCO5686
Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SCO5687
Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SCO5688
Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SCO5689
Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCO5690
Name: SAV_2572 Funciton: Predicted secreted protein
Locus tag: SCO5691
Name: SAV_2571 Funciton: Predicted sugar hydrolase |
||||
| SAV_2577-SAV_2576-SAV_2575-SAV_2573-SAV_2572-SAV_2571 | -218 | 6.3 | ACGTCGAAGCGCTTCGATGC | SCO5686 |
| -109 | 6.7 | ACATCGAAGCGCTTCGACAC | ||
| Streptomyces scabiei 87.22 | ||||
|
Position: -151
Score: 6.71373 Sequence: ACATCGAAGCGCTTCGACTG
Locus tag: SCAB_25621
Name: SAV_2577 Funciton: Predicted multiple sugar ABC transporter, substrate-binding protein
Locus tag: SCAB_25611
Name: SAV_2576 Funciton: Predicted multiple sugar ABC transporter, permease protein 1
Locus tag: SCAB_25601
Name: SAV_2575 Funciton: Predicted multiple sugar ABC transporter, permease protein 2
Locus tag: SCAB_25591
Name: SAV_2574 Funciton: Predicted glycosyl hydrolase
Locus tag: SCAB_25581
Name: SAV_2573 Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCAB_25571
Name: SAV_2571 Funciton: Predicted sugar hydrolase |
||||
| SAV_2577-SAV_2576-SAV_2575-SAV_2574-SAV_2573-SAV_2571 | -151 | 6.7 | ACATCGAAGCGCTTCGACTG | SCAB_25621 |