Orthologous regulated operons containing malL gene
| Regulog: | MalR2 - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus cereus ATCC 14579 | ||||
|
Position: -241
Score: 5.04573 Sequence: TTATGCAAACGTTTTCTTTG
Position: -63
Score: 4.90879 Sequence: TAATGAAAACGTTTGCGCCT
Locus tag: BC4015
Name: null Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10) |
||||
| BC4015 | -241 | 5 | TTATGCAAACGTTTTCTTTG | BC4015 |
| -63 | 4.9 | TAATGAAAACGTTTGCGCCT | ||
| Bacillus halodurans C-125 | ||||
|
Position: -32
Score: 5.41834 Sequence: TTACGTAAACGTTTTCGTTA
Locus tag: BH2903
Name: BH2903 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10) |
||||
| BH2903 | -32 | 5.4 | TTACGTAAACGTTTTCGTTA | BH2903 |