Orthologous regulated operons containing pell gene
Regulog: | ExuR - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galacturonate utilization |
Effector: | Galacturonate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium acetobutylicum ATCC 824 | ||||
Position: -46
Score: 6.08787 Sequence: AAATGTTAACGTTAACATAA
Locus tag: CAP0056
Name: pell Funciton: Pectate lyase, secreted, polysaccharide lyase family |
||||
pell | -46 | 6.1 | AAATGTTAACGTTAACATAA | CAP0056 |
Clostridium butyricum 5521 | ||||
Position: -43
Score: 5.95041 Sequence: AATTGTTAACGATAACAATA
Locus tag: CBY_3715
Name: null Funciton: Pectate lyase, secreted, polysaccharide lyase family |
||||
CBY_3715 | -43 | 6 | AATTGTTAACGATAACAATA | CBY_3715 |