Orthologous regulated operons containing exuR gene
Regulog: | ExuR - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galacturonate utilization |
Effector: | Galacturonate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium acetobutylicum ATCC 824 | ||||
Position: -121
Score: 5.69303 Sequence: AGTTGTTCACGTTCACAAAA
Locus tag: CAC0692
Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12)
Locus tag: CAC0693
Name: exuR Funciton: Hexuronate utilization transcriptional repressor ExuR, LacI family
Locus tag: CAC0694
Name: uxaT Funciton: Galacturonate transporter UxaT |
||||
uxaC-exuR-uxaT | -121 | 5.7 | AGTTGTTCACGTTCACAAAA | CAC0692 |