Orthologous regulated operons containing bgaR gene
| Regulog: | BgaR - Micrococcineae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||||
|
Position: -2
Score: 6.49988 Sequence: GGGTGTTTGCGCAAACATCT
Locus tag: CMM_2696
Name: bgaR Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
||||
| bgaR | -2 | 6.5 | GGGTGTTTGCGCAAACATCT | CMM_2696 |
| Jonesia denitrificans DSM 20603 | ||||
|
Position: -143
Score: 6.49988 Sequence: CGATGTTTACGTCAACATCT
Position: -111
Score: 6.34263 Sequence: GCATGTTTACGCAAACATCG
Locus tag: Jden_0100
Name: bgaR Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
||||
| bgaR | -143 | 6.5 | CGATGTTTACGTCAACATCT | Jden_0100 |
| -111 | 6.3 | GCATGTTTACGCAAACATCG | ||