Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rhaR gene

Properties
Regulog: RhaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Phylum: Actinobacteria
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -225
Score: 5.8925
Sequence: CGTATGAAACGATTCAGGAG
Locus tag: SAV_7416
Name: rhaG
Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SAV_7417
Name: rhaH
Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SAV_7418
Name: rhaJ
Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SAV_7419
Name: rhaF
Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SAV_7420
Name: rhaM
Funciton: L-rhamnose mutarotase
Locus tag: SAV_7421
Name: rhaX
Funciton: Putative rhamnoside hydrolase
Locus tag: SAV_7422
Name: rhaR
Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG-rhaH-rhaJ-rhaF-rhaM-rhaX-rhaR -225 5.9 CGTATGAAACGATTCAGGAG SAV_7416
Streptomyces coelicolor A3(2)
Position: -228
Score: 6.0716
Sequence: TGTGTGAAACGATTCAGAAC
Locus tag: SCO0811
Name: rhaG
Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SCO0810
Name: rhaH
Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SCO0809
Name: rhaJ
Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SCO0808
Name: rhaF
Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SCO0807
Name: rhaM
Funciton: L-rhamnose mutarotase
Locus tag: SCO0806
Name: rhaR
Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG-rhaH-rhaJ-rhaF-rhaM-rhaR -228 6.1 TGTGTGAAACGATTCAGAAC SCO0811
Streptomyces scabiei 87.22
Position: -235
Score: 6.24182
Sequence: TGTCTGAAACGATTCAGCAA
Locus tag: SCAB_9431
Name: rhaG
Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SCAB_9421
Name: rhaH
Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SCAB_9411
Name: rhaJ
Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SCAB_9401
Name: rhaF
Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SCAB_9391
Name: rhaM
Funciton: L-rhamnose mutarotase
Locus tag: SCAB_9381
Name: rhaX
Funciton: Putative rhamnoside hydrolase
Locus tag: SCAB_9371
Name: rhaR
Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family
rhaG-rhaH-rhaJ-rhaF-rhaM-rhaX-rhaR -235 6.2 TGTCTGAAACGATTCAGCAA SCAB_9431