Orthologous regulated operons containing rhaX gene
| Regulog: | RhaR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose utilization |
| Effector: | Rhamnose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -225
Score: 5.8925 Sequence: CGTATGAAACGATTCAGGAG
Locus tag: SAV_7416
Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SAV_7417
Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SAV_7418
Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SAV_7419
Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SAV_7420
Name: rhaM Funciton: L-rhamnose mutarotase
Locus tag: SAV_7421
Name: rhaX Funciton: Putative rhamnoside hydrolase
Locus tag: SAV_7422
Name: rhaR Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family |
||||
| rhaG-rhaH-rhaJ-rhaF-rhaM-rhaX-rhaR | -225 | 5.9 | CGTATGAAACGATTCAGGAG | SAV_7416 |
| Streptomyces scabiei 87.22 | ||||
|
Position: -235
Score: 6.24182 Sequence: TGTCTGAAACGATTCAGCAA
Locus tag: SCAB_9431
Name: rhaG Funciton: L-rhamnose ABC transporter, duplicated ATP-binding component
Locus tag: SCAB_9421
Name: rhaH Funciton: L-rhamnose ABC transporter, permease component 1
Locus tag: SCAB_9411
Name: rhaJ Funciton: L-rhamnose ABC transporter, permease component 2
Locus tag: SCAB_9401
Name: rhaF Funciton: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
Locus tag: SCAB_9391
Name: rhaM Funciton: L-rhamnose mutarotase
Locus tag: SCAB_9381
Name: rhaX Funciton: Putative rhamnoside hydrolase
Locus tag: SCAB_9371
Name: rhaR Funciton: Rhamnose utilization transcriptional regulator RhaR, LacI family |
||||
| rhaG-rhaH-rhaJ-rhaF-rhaM-rhaX-rhaR | -235 | 6.2 | TGTCTGAAACGATTCAGCAA | SCAB_9431 |