Orthologous regulated operons containing sacF gene
| Regulog: | ScrR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus clausii KSM-K16 | ||||
|
Position: -83
Score: 7.58808 Sequence: TATGTCAACCGGTTGACATA
Locus tag: ABC3119
Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
Locus tag: ABC3118
Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
Locus tag: ABC3117
Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
Locus tag: ABC3116
Name: sacC Funciton: Levanase (EC 3.2.1.65)
Locus tag: ABC3115
Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26) |
||||
| sacH-sacG-sacF-sacC-cscA | -83 | 7.6 | TATGTCAACCGGTTGACATA | ABC3119 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -97
Score: 7.58808 Sequence: TATGTCAACCGGTTGACATA
Locus tag: BLi04182
Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
Locus tag: BLi04181
Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
Locus tag: BLi04180
Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
Locus tag: BLi04179
Name: cscB Funciton: Sucrose permease, major facilitator superfamily
Locus tag: BLi04178
Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26) |
||||
| sacF-sacH-sacG-cscB-cscA | -97 | 7.6 | TATGTCAACCGGTTGACATA | BLi04182 |
| Paenibacillus sp. JDR-2 | ||||
|
Position: -103
Score: 7.31438 Sequence: TATGTCATCCGGTTGACATA
Locus tag: Pjdr2_5213
Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
Locus tag: Pjdr2_5214
Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
Locus tag: Pjdr2_5215
Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
Locus tag: Pjdr2_5216
Name: sacC Funciton: Levanase (EC 3.2.1.65) |
||||
| sacH-sacG-sacF-sacC | -103 | 7.3 | TATGTCATCCGGTTGACATA | Pjdr2_5213 |