Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sacC gene

Properties
Regulog: ScrR - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -83
Score: 7.58808
Sequence: TATGTCAACCGGTTGACATA
Locus tag: ABC3119
Name: sacH
Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
Locus tag: ABC3118
Name: sacG
Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
Locus tag: ABC3117
Name: sacF
Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
Locus tag: ABC3116
Name: sacC
Funciton: Levanase (EC 3.2.1.65)
Locus tag: ABC3115
Name: cscA
Funciton: Sucrose hydrolase (EC 3.2.1.26)
sacH-sacG-sacF-sacC-cscA -83 7.6 TATGTCAACCGGTTGACATA ABC3119
Paenibacillus sp. JDR-2
Position: -103
Score: 7.31438
Sequence: TATGTCATCCGGTTGACATA
Locus tag: Pjdr2_5213
Name: sacH
Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
Locus tag: Pjdr2_5214
Name: sacG
Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
Locus tag: Pjdr2_5215
Name: sacF
Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
Locus tag: Pjdr2_5216
Name: sacC
Funciton: Levanase (EC 3.2.1.65)
sacH-sacG-sacF-sacC -103 7.3 TATGTCATCCGGTTGACATA Pjdr2_5213
© 2009-2020 RegPrecise