Orthologous regulated operons containing BC2796 gene
Regulog: | GntR2 - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Gluconate utilization |
Effector: | D-gluconate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus clausii KSM-K16 | ||||
Position: -32
Score: 6.79103 Sequence: CTACTAAATCGGTTTAGTAA
Locus tag: ABC3358
Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family
Locus tag: ABC3357
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, periplasmic component
Locus tag: ABC3356
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, small permease component
Locus tag: ABC3355
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, large permease component
Locus tag: ABC3354
Name: PF01380 Funciton: Putative sugar phosphate isomerase, PF01380 family
Locus tag: ABC3353
Name: null Funciton: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
Locus tag: ABC3352
Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: ABC3351
Name: PF00215 Funciton: Putative sugar-phosphate decarboxylase, PF00215 family |
||||
gntR2-ABC3357-ABC3356-ABC3355-PF01380-ABC3353-kdgK-PF00215 | -32 | 6.8 | CTACTAAATCGGTTTAGTAA | ABC3358 |
Oceanobacillus iheyensis HTE831 | ||||
Position: -54
Score: 6.80988 Sequence: TTACTAAATCGATTTACTAA
Position: -41
Score: 5.57204 Sequence: TTACTAAACCGTTTTAGTTA
Locus tag: OB2705
Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family
Locus tag: OB2704
Name: PF01380 Funciton: Putative sugar phosphate isomerase, PF01380 family
Locus tag: OB2703
Name: kdgA Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: OB2702
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, periplasmic component
Locus tag: OB2701
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, small permease component
Locus tag: OB2700
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, large permease component
Locus tag: OB2699
Name: null Funciton: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
Locus tag: OB2698
Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: OB2697
Name: PF00215 Funciton: Putative sugar-phosphate decarboxylase, PF00215 family |
||||
gntR2-PF01380-kdgA-OB2702-OB2701-OB2700-OB2699-kdgK-PF00215 | -54 | 6.8 | TTACTAAATCGATTTACTAA | OB2705 |
-41 | 5.6 | TTACTAAACCGTTTTAGTTA |