Orthologous regulated operons containing gntR2 gene
| Regulog: | GntR2 - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | D-gluconate |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -53
Score: 6.00139 Sequence: TTACTAAACCGGTTTACCAA
Position: -40
Score: 5.68324 Sequence: TTACCAAACCGATTTAGTCT
Locus tag: RBAM_017950
Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: RBAM_017960
Name: yjmD Funciton: Predicted mannuronate reductase (EC 1.1.1.131)
Locus tag: RBAM_017970
Name: kdgA Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: RBAM_017980
Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8)
Locus tag: RBAM_017990
Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: RBAM_018000
Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family
Locus tag: RBAM_018010
Name: exuT Funciton: Hexuronate transporter |
||||
| kdgK-yjmD-kdgA-uxuA-uxuB-gntR2-exuT | -53 | 6 | TTACTAAACCGGTTTACCAA | RBAM_017950 |
| -40 | 5.7 | TTACCAAACCGATTTAGTCT | ||
| Bacillus clausii KSM-K16 | ||||
|
Position: -32
Score: 6.79103 Sequence: CTACTAAATCGGTTTAGTAA
Locus tag: ABC3358
Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family
Locus tag: ABC3357
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, periplasmic component
Locus tag: ABC3356
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, small permease component
Locus tag: ABC3355
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, large permease component
Locus tag: ABC3354
Name: PF01380 Funciton: Putative sugar phosphate isomerase, PF01380 family
Locus tag: ABC3353
Name: null Funciton: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
Locus tag: ABC3352
Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: ABC3351
Name: PF00215 Funciton: Putative sugar-phosphate decarboxylase, PF00215 family |
||||
| gntR2-ABC3357-ABC3356-ABC3355-PF01380-ABC3353-kdgK-PF00215 | -32 | 6.8 | CTACTAAATCGGTTTAGTAA | ABC3358 |
| Geobacillus kaustophilus HTA426 | ||||
|
Position: -36
Score: 6.37203 Sequence: GAACTAAATCGATTTAGTCT
Locus tag: GK1942
Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family
Locus tag: GK1941
Name: gntK Funciton: Gluconokinase (EC 2.7.1.12) |
||||
| gntR2-gntK | -36 | 6.4 | GAACTAAATCGATTTAGTCT | GK1942 |
| Oceanobacillus iheyensis HTE831 | ||||
|
Position: -54
Score: 6.80988 Sequence: TTACTAAATCGATTTACTAA
Position: -41
Score: 5.57204 Sequence: TTACTAAACCGTTTTAGTTA
Locus tag: OB2705
Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family
Locus tag: OB2704
Name: PF01380 Funciton: Putative sugar phosphate isomerase, PF01380 family
Locus tag: OB2703
Name: kdgA Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: OB2702
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, periplasmic component
Locus tag: OB2701
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, small permease component
Locus tag: OB2700
Name: null Funciton: TRAP-type C4-dicarboxylate transport system, large permease component
Locus tag: OB2699
Name: null Funciton: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
Locus tag: OB2698
Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: OB2697
Name: PF00215 Funciton: Putative sugar-phosphate decarboxylase, PF00215 family |
||||
| gntR2-PF01380-kdgA-OB2702-OB2701-OB2700-OB2699-kdgK-PF00215 | -54 | 6.8 | TTACTAAATCGATTTACTAA | OB2705 |
| -41 | 5.6 | TTACTAAACCGTTTTAGTTA | ||