Orthologous regulated operons containing scrK gene
| Regulog: | SCO1956 - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -100
Score: 7.74597 Sequence: AAACGCTTGCGCAAGCGTTT
Locus tag: SAV_6288
Name: SCO1956 Funciton: Transcriptional regulator, LacI family
Locus tag: SAV_6287
Name: scrK Funciton: Fructokinase (EC 2.7.1.4) |
||||
| SCO1956-scrK | -100 | 7.7 | AAACGCTTGCGCAAGCGTTT | SAV_6288 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -85
Score: 7.74597 Sequence: AAACGCTTGCGCAAGCGTTT
Locus tag: SCO1956
Name: SCO1956 Funciton: Transcriptional regulator, LacI family
Locus tag: SCO1957
Name: scrK Funciton: Fructokinase (EC 2.7.1.4) |
||||
| SCO1956-scrK | -85 | 7.7 | AAACGCTTGCGCAAGCGTTT | SCO1956 |