Orthologous regulated operons containing SCO1956 gene
Regulog: | SCO1956 - Streptomycetaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptomyces avermitilis MA-4680 | ||||
Position: -100
Score: 7.74597 Sequence: AAACGCTTGCGCAAGCGTTT
Locus tag: SAV_6288
Name: SCO1956 Funciton: Transcriptional regulator, LacI family
Locus tag: SAV_6287
Name: scrK Funciton: Fructokinase (EC 2.7.1.4) |
||||
SCO1956-scrK | -100 | 7.7 | AAACGCTTGCGCAAGCGTTT | SAV_6288 |
Streptomyces coelicolor A3(2) | ||||
Position: -85
Score: 7.74597 Sequence: AAACGCTTGCGCAAGCGTTT
Locus tag: SCO1956
Name: SCO1956 Funciton: Transcriptional regulator, LacI family
Locus tag: SCO1957
Name: scrK Funciton: Fructokinase (EC 2.7.1.4) |
||||
SCO1956-scrK | -85 | 7.7 | AAACGCTTGCGCAAGCGTTT | SCO1956 |