Orthologous regulated operons containing THA_1504 gene

Properties
Regulog:	THA_1503 - Thermotogales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Thermotogae

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Fervidobacterium nodosum Rt17-B1
Position: -77 Score: 7.50011 Sequence: AGTGTTATATAATTATATAACACT Locus tag: Fnod_0542 Name: THA_1504 Funciton: hypothetical protein Locus tag: Fnod_0541 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Fnod_0540 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Fnod_0539 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-THA_1503-THA_1502-THA_1501	-77	7.5	AGTGTTATATAATTATATAACACT	Fnod_0542
Petrotoga mobilis SJ95
Position: -46 Score: 6.1537 Sequence: TGTGTTATAGTTAAATATAACAAC Locus tag: Pmob_0665 Name: THA_1504 Funciton: hypothetical protein Locus tag: Pmob_0664 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Pmob_0663 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Pmob_0662 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-THA_1503-THA_1502-THA_1501	-46	6.2	TGTGTTATAGTTAAATATAACAAC	Pmob_0665
Thermosipho africanus TCF52B
Position: -56 Score: 6.66318 Sequence: TGTGTTATACTTTTATAGAACACT Locus tag: THA_1504 Name: THA_1504 Funciton: hypothetical protein Locus tag: THA_1503 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: THA_1502 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: THA_1501 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-THA_1503-THA_1502-THA_1501	-56	6.7	TGTGTTATACTTTTATAGAACACT	THA_1504
Thermosipho melanesiensis BI429
Position: -1 Score: 6.40059 Sequence: TGTGTTATACTTATATAGAACAAT Locus tag: Tmel_1358 Name: THA_1504 Funciton: hypothetical protein Locus tag: Tmel_1357 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Tmel_1356 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Tmel_1355 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-THA_1503-THA_1502-THA_1501	-1	6.4	TGTGTTATACTTATATAGAACAAT	Tmel_1358
Thermotoga lettingae TMO
Position: -46 Score: 6.45247 Sequence: AGTGTTCTAATAATATAGAACAAT Locus tag: Tlet_0734 Name: THA_1504 Funciton: hypothetical protein Locus tag: Tlet_0735 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Tlet_0736 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Tlet_0737 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-THA_1503-THA_1502-THA_1501	-46	6.5	AGTGTTCTAATAATATAGAACAAT	Tlet_0734
Thermotogales bacterium TBF 19.5.1
Position: -49 Score: 6.25601 Sequence: AGTGTTCTAATAAAGTAGAACACT Locus tag: Kole_0655 Name: THA_1504 Funciton: hypothetical protein Locus tag: Kole_0656 Name: THA_1503 Funciton: Transcriptional regulator, GntR family Locus tag: Kole_0657 Name: THA_1502 Funciton: ABC transporter, permease protein Locus tag: Kole_0658 Name: THA_1501 Funciton: ABC transporter, ATP-binding protein
THA_1504-THA_1503-THA_1502-THA_1501	-49	6.3	AGTGTTCTAATAAAGTAGAACACT	Kole_0655