Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing kguM gene

Properties
Regulog: PtxS - Burkholderia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: 2-ketogluconate utilization
Effector: 2-keto-D-gluconate
Phylum: Proteobacteria/beta
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia phymatum STM815
Position: -52
Score: 5.82847
Sequence: CTTTGGAACCGATTCCAAAG
Locus tag: Bphy_1254
Name: kguE
Funciton: Predicted epimerase/isomerase
Locus tag: Bphy_1253
Name: kguK
Funciton: 2-ketogluconate kinase (EC 2.7.1.13)
Locus tag: Bphy_1252
Name: kguT
Funciton: 2-ketogluconate transporter
Locus tag: Bphy_1251
Name: kguD
Funciton: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)
Locus tag: Bphy_1250
Name: ptxS
Funciton: 2-ketogluconate utilization repressor PtxS, LacI family
Locus tag: Bphy_1249
Name: kguM
Funciton: Membrane protein in 2-ketogluconate utilization locus
Locus tag: Bphy_1248
Name: kguX
Funciton: Conserved hypothetical protein
kguE-kguK-kguT-kguD-ptxS-kguM-kguX -52 5.8 CTTTGGAACCGATTCCAAAG Bphy_1254
Burkholderia xenovorans LB400
Position: -52
Score: 6.53653
Sequence: ATTTGGAACCGGTTCCAAAT
Locus tag: Bxe_A1979
Name: kguE
Funciton: Predicted epimerase/isomerase
Locus tag: Bxe_A1980
Name: kguK
Funciton: 2-ketogluconate kinase (EC 2.7.1.13)
Locus tag: Bxe_A1981
Name: kguT
Funciton: 2-ketogluconate transporter
Locus tag: Bxe_A1982
Name: kguD
Funciton: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)
Locus tag: Bxe_A1983
Name: ptxS
Funciton: 2-ketogluconate utilization repressor PtxS, LacI family
Locus tag: Bxe_A1984
Name: kguM
Funciton: Membrane protein in 2-ketogluconate utilization locus
Locus tag: Bxe_A1985
Name: kguX
Funciton: Conserved hypothetical protein
kguE-kguK-kguT-kguD-ptxS-kguM-kguX -52 6.5 ATTTGGAACCGGTTCCAAAT Bxe_A1979