Orthologous regulated operons containing talR gene
| Regulog: | TalR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | L-talarate utilization |
| Effector: | L-talarate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -193
Score: 6.1261 Sequence: TAATGATTGCGCAATCACCA
Locus tag: ECA0997
Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family |
||||
| talR | -193 | 6.1 | TAATGATTGCGCAATCACCA | ECA0997 |
| Salmonella typhimurium LT2 | ||||
|
Position: -296
Score: 6.69514 Sequence: AAATGATTGCGCTAACATTT
Position: -143
Score: 6.71116 Sequence: AAATGATGGCGCTATCATTT
Locus tag: STM3696
Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family |
||||
| talR | -296 | 6.7 | AAATGATTGCGCTAACATTT | STM3696 |
| -143 | 6.7 | AAATGATGGCGCTATCATTT | ||