Orthologous regulated operons containing nhaX gene
| Regulog: | STM1555 - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photorhabdus luminescens subsp. laumondii TTO1 | ||||
|
Position: -105
Score: 6.21983 Sequence: TTATGAAACCAATTACATGA
Locus tag: plu3732
Name: nhaX Funciton: Predicted sugar transporter, Na+/H+ antiporter family
Locus tag: plu3731
Name: malY Funciton: beta-cystathionase; Maltose regulon modulator |
||||
| nhaX-malY | -105 | 6.2 | TTATGAAACCAATTACATGA | plu3732 |
| Salmonella typhimurium LT2 | ||||
|
Position: -95
Score: 6.72491 Sequence: TCATGTAATCGGTTACATGG
Locus tag: STM1556
Name: nhaX Funciton: Predicted sugar transporter, Na+/H+ antiporter family
Locus tag: STM1557
Name: malY Funciton: beta-cystathionase; Maltose regulon modulator |
||||
| nhaX-malY | -95 | 6.7 | TCATGTAATCGGTTACATGG | STM1556 |
| Serratia proteamaculans 568 | ||||
|
Position: -100
Score: 6.64156 Sequence: TCATGAAACCGATTACATGG
Locus tag: Spro_3617
Name: nhaX Funciton: Predicted sugar transporter, Na+/H+ antiporter family
Locus tag: Spro_3618
Name: malY Funciton: beta-cystathionase; Maltose regulon modulator |
||||
| nhaX-malY | -100 | 6.6 | TCATGAAACCGATTACATGG | Spro_3617 |