Orthologous regulated operons containing bglG gene

Properties
Regulog:	BglR - Burkholderia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/beta

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia phymatum STM815
Position: -86 Score: 7.14561 Sequence: ATGTGGAAGCGCTTCCACTC Locus tag: Bphy_5434 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Bphy_5435 Name: bglE Funciton: Beta-glucosides specific ABC transporter, substrate-binding protein Locus tag: Bphy_5436 Name: bglF Funciton: Beta-glucosides specific ABC transporter, permease protein 1 Locus tag: Bphy_5437 Name: bglG Funciton: Beta-glucosides specific ABC transporter, permease protein 2 Locus tag: Bphy_5438 Name: bglK Funciton: Beta-glucosides specific ABC transporter, ATP-binding protein Locus tag: Bphy_5439 Name: bglR Funciton: Beta-glucosides utilization transcriptional regulator BglR, LacI family
bglB-bglE-bglF-bglG-bglK-bglR	-86	7.1	ATGTGGAAGCGCTTCCACTC	Bphy_5434
Burkholderia xenovorans LB400
Position: -172 Score: 7.14561 Sequence: GTGTGGAAGCGCTTCCACTT Locus tag: Bxe_B2084 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Bxe_B2083 Name: bglE Funciton: Beta-glucosides specific ABC transporter, substrate-binding protein Locus tag: Bxe_B2082 Name: bglF Funciton: Beta-glucosides specific ABC transporter, permease protein 1 Locus tag: Bxe_B2081 Name: bglG Funciton: Beta-glucosides specific ABC transporter, permease protein 2 Locus tag: Bxe_B2080 Name: bglK Funciton: Beta-glucosides specific ABC transporter, ATP-binding protein Locus tag: Bxe_B2079 Name: bglR Funciton: Beta-glucosides utilization transcriptional regulator BglR, LacI family
bglB-bglE-bglF-bglG-bglK-bglR	-172	7.1	GTGTGGAAGCGCTTCCACTT	Bxe_B2084