Orthologous regulated operons containing bglB gene
| Regulog: | BglR - Burkholderia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Burkholderia phymatum STM815 | ||||
|
Position: -86
Score: 7.14561 Sequence: ATGTGGAAGCGCTTCCACTC
Locus tag: Bphy_5434
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Bphy_5435
Name: bglE Funciton: Beta-glucosides specific ABC transporter, substrate-binding protein
Locus tag: Bphy_5436
Name: bglF Funciton: Beta-glucosides specific ABC transporter, permease protein 1
Locus tag: Bphy_5437
Name: bglG Funciton: Beta-glucosides specific ABC transporter, permease protein 2
Locus tag: Bphy_5438
Name: bglK Funciton: Beta-glucosides specific ABC transporter, ATP-binding protein
Locus tag: Bphy_5439
Name: bglR Funciton: Beta-glucosides utilization transcriptional regulator BglR, LacI family |
||||
| bglB-bglE-bglF-bglG-bglK-bglR | -86 | 7.1 | ATGTGGAAGCGCTTCCACTC | Bphy_5434 |
| Burkholderia xenovorans LB400 | ||||
|
Position: -172
Score: 7.14561 Sequence: GTGTGGAAGCGCTTCCACTT
Locus tag: Bxe_B2084
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Bxe_B2083
Name: bglE Funciton: Beta-glucosides specific ABC transporter, substrate-binding protein
Locus tag: Bxe_B2082
Name: bglF Funciton: Beta-glucosides specific ABC transporter, permease protein 1
Locus tag: Bxe_B2081
Name: bglG Funciton: Beta-glucosides specific ABC transporter, permease protein 2
Locus tag: Bxe_B2080
Name: bglK Funciton: Beta-glucosides specific ABC transporter, ATP-binding protein
Locus tag: Bxe_B2079
Name: bglR Funciton: Beta-glucosides utilization transcriptional regulator BglR, LacI family |
||||
| bglB-bglE-bglF-bglG-bglK-bglR | -172 | 7.1 | GTGTGGAAGCGCTTCCACTT | Bxe_B2084 |