Orthologous regulated operons containing glgP gene
| Regulog: | MalR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Glaciecola sp. HTCC2999 | ||||
|
Position: -122
Score: 5.35222 Sequence: AAATGCATACGAATTCAGTC
Locus tag: GHTCC_010100010210
Name: glgP Funciton: Glycogen phosphorylase (EC 2.4.1.1) |
||||
| glgP | -122 | 5.4 | AAATGCATACGAATTCAGTC | GHTCC_010100010210 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -166
Score: 5.81646 Sequence: GGTTGAATACGTATTCAACC
Locus tag: Patl_2197
Name: glgP Funciton: Glycogen phosphorylase (EC 2.4.1.1) |
||||
| glgP | -166 | 5.8 | GGTTGAATACGTATTCAACC | Patl_2197 |