Orthologous regulated operons containing glgX gene

Properties
Regulog:	MalR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Proteobacteria/gamma

Built upon 44 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonas macleodii 'Deep ecotype'
Position: -124 Score: 5.17798 Sequence: TATTGCAATCGTATTCAGAT Locus tag: MADE_01251 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: MADE_01252 Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18) Locus tag: MADE_01253 Name: glgX Funciton: Glycogen debranching enzyme (EC 3.2.1.-)
malQ-glgB-glgX	-124	5.2	TATTGCAATCGTATTCAGAT	MADE_01251
Glaciecola sp. HTCC2999
Position: -83 Score: 5.96821 Sequence: TTTTGCAAACGTATTCAATA Locus tag: GHTCC_010100004775 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: GHTCC_010100004780 Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18) Locus tag: GHTCC_010100004785 Name: glgX Funciton: Glycogen debranching enzyme (EC 3.2.1.-)
malQ-glgB-glgX	-83	6	TTTTGCAAACGTATTCAATA	GHTCC_010100004775
Pseudoalteromonas atlantica T6c
Position: -90 Score: 5.68746 Sequence: TAATGCAAACGTATTCAACT Locus tag: Patl_1635 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: Patl_1636 Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18) Locus tag: Patl_1637 Name: glgX Funciton: Glycogen debranching enzyme (EC 3.2.1.-)
malQ-glgB-glgX	-90	5.7	TAATGCAAACGTATTCAACT	Patl_1635

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --