Orthologous regulated operons containing omp(Mal)2 gene

Properties
Regulog:	MalR - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Proteobacteria/gamma

Built upon 44 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Alteromonadales bacterium TW-7
Position: -108 Score: 6.05308 Sequence: TACTGCATACGTATTCATCA Locus tag: ATW7_17257 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: ATW7_17262 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
omp(Mal)2-pulA	-108	6.1	TACTGCATACGTATTCATCA	ATW7_17257
Alteromonas macleodii 'Deep ecotype'
Position: -130 Score: 5.72392 Sequence: AAATGAATACGTATGCACAG Locus tag: MADE_01881 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: MADE_01882 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
omp(Mal)2-pulA	-130	5.7	AAATGAATACGTATGCACAG	MADE_01881
Colwellia psychrerythraea 34H
Position: -129 Score: 6.30448 Sequence: TTTTGAATACGTATGCAAAA Locus tag: CPS_1693 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: CPS_1694 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
omp(Mal)2-pulA	-129	6.3	TTTTGAATACGTATGCAAAA	CPS_1693
Pseudoalteromonas atlantica T6c
Position: -167 Score: 5.99568 Sequence: TGTTGAATACGTATGCAGTG Locus tag: Patl_1940 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: Patl_1941 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
omp(Mal)2-pulA	-167	6	TGTTGAATACGTATGCAGTG	Patl_1940

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --