Orthologous regulated operons containing gal6 gene

Properties
Regulog:	BgaR - Streptomycetaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Phylum:	Actinobacteria

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -110 Score: 6.93314 Sequence: AGATGTTTACGTAAACATAA Locus tag: SAV_1030 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: SAV_1029 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: SAV_1028 Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component Locus tag: SAV_1027 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SAV_1026 Name: gal6 Funciton: Endo-beta-1,6-galactanase
bgaZ-bgaY-bgaX-bgaB-gal6	-110	6.9	AGATGTTTACGTAAACATAA	SAV_1030
Streptomyces coelicolor A3(2)
Position: -101 Score: 6.93314 Sequence: AGATGTTTACGTAAACATAA Position: -56 Score: 7.09567 Sequence: TCATGTTTACGTAAACATCA Locus tag: SCO7410 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: SCO7409 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: SCO7408 Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component Locus tag: SCO7407 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SCO7406 Name: gal6 Funciton: Endo-beta-1,6-galactanase
bgaZ-bgaY-bgaX-bgaB-gal6	-101	6.9	AGATGTTTACGTAAACATAA	SCO7410
	-56	7.1	TCATGTTTACGTAAACATCA
Streptomyces scabiei 87.22
Position: -186 Score: 7.17867 Sequence: GGATGTTTACGTAAACATCC Locus tag: SCAB_43661 Name: gal6 Funciton: Endo-beta-1,6-galactanase
gal6	-186	7.2	GGATGTTTACGTAAACATCC	SCAB_43661