Orthologous regulated operons containing bgaX gene
| Regulog: | BgaR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -110
Score: 6.93314 Sequence: AGATGTTTACGTAAACATAA
Locus tag: SAV_1030
Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: SAV_1029
Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: SAV_1028
Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component
Locus tag: SAV_1027
Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SAV_1026
Name: gal6 Funciton: Endo-beta-1,6-galactanase |
||||
| bgaZ-bgaY-bgaX-bgaB-gal6 | -110 | 6.9 | AGATGTTTACGTAAACATAA | SAV_1030 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -101
Score: 6.93314 Sequence: AGATGTTTACGTAAACATAA
Position: -56
Score: 7.09567 Sequence: TCATGTTTACGTAAACATCA
Locus tag: SCO7410
Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: SCO7409
Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: SCO7408
Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component
Locus tag: SCO7407
Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
Locus tag: SCO7406
Name: gal6 Funciton: Endo-beta-1,6-galactanase |
||||
| bgaZ-bgaY-bgaX-bgaB-gal6 | -101 | 6.9 | AGATGTTTACGTAAACATAA | SCO7410 |
| -56 | 7.1 | TCATGTTTACGTAAACATCA | ||