Orthologous regulated operons containing lp_2744 gene

Properties
Regulog:	Nfa3720 - Nocardiaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Actinobacteria

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -20 Score: 6.99866 Sequence: TATGGTTCATTACATGAGTAATGAACCACT Locus tag: nfa3720 Name: Nfa3720 Funciton: Transcriptional regulator, GntR family Locus tag: nfa3730 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: nfa3740 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
Nfa3720-lp_2743-lp_2744	-20	7	TATGGTTCATTACATGAGTAATGAACCACT	nfa3720
Rhodococcus erythropolis PR4
Position: -51 Score: 6.60131 Sequence: TATGGTTCATTACATGAGCAATGAACCAGT Locus tag: RER_12520 Name: Nfa3720 Funciton: Transcriptional regulator, GntR family Locus tag: RER_12510 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: RER_12500 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
Nfa3720-lp_2743-lp_2744	-51	6.6	TATGGTTCATTACATGAGCAATGAACCAGT	RER_12520
Rhodococcus opacus B4
Position: -51 Score: 6.96152 Sequence: TATGGTTCATTACATGAGTAATGAACCGAT Locus tag: ROP_66420 Name: Nfa3720 Funciton: Transcriptional regulator, GntR family Locus tag: ROP_66410 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: ROP_66400 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
Nfa3720-lp_2743-lp_2744	-51	7	TATGGTTCATTACATGAGTAATGAACCGAT	ROP_66420

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --