Orthologous regulated operons containing galR gene
| Regulog: | GalR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -152
Score: 5.00608 Sequence: TACTGATAACGATTACAAAA
Locus tag: PBPRA2078
Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family |
||||
| galR | -152 | 5 | TACTGATAACGATTACAAAA | PBPRA2078 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -139
Score: 5.45537 Sequence: CATTAAAAACGTTTACACTT
Locus tag: VC2337
Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family |
||||
| galR | -139 | 5.5 | CATTAAAAACGTTTACACTT | VC2337 |
| Vibrio fischeri ES114 | ||||
|
Position: -107
Score: 5.72277 Sequence: TAATGATAACGTTTACAAAA
Locus tag: VF_A0361
Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family |
||||
| galR | -107 | 5.7 | TAATGATAACGTTTACAAAA | VF_A0361 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -149
Score: 4.66013 Sequence: CTAAGATAACGTTTATACAT
Locus tag: VIBHAR_03325
Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family |
||||
| galR | -149 | 4.7 | CTAAGATAACGTTTATACAT | VIBHAR_03325 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -149
Score: 5.57747 Sequence: AAAAGATAACGTTTACACTA
Locus tag: VP2393
Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family |
||||
| galR | -149 | 5.6 | AAAAGATAACGTTTACACTA | VP2393 |
| Vibrio shilonii AK1 | ||||
|
Position: -245
Score: 5.60066 Sequence: TCATGGAAACGTTTACAATT
Position: -115
Score: 5.22353 Sequence: TTTTGGAAACGATTACTCTA
Locus tag: VSAK1_00922
Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family |
||||
| galR | -245 | 5.6 | TCATGGAAACGTTTACAATT | VSAK1_00922 |
| -115 | 5.2 | TTTTGGAAACGATTACTCTA | ||