Orthologous regulated operons containing omp gene
| Regulog: | PFL_0254 - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -24
Score: 6.83937 Sequence: CGATGTTAGCGCTAACAAAG
Locus tag: PFL_0255
Name: omp Funciton: Hypothetical sugar outer membrane transporter, TonB-dependent |
||||
| omp | -24 | 6.8 | CGATGTTAGCGCTAACAAAG | PFL_0255 |