Orthologous regulated operons containing galP gene
Regulog: | GalR - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Galactose utilization |
Effector: | Galactose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudoalteromonas haloplanktis TAC125 | ||||
Position: -54
Score: 6.31547 Sequence: CGGGGTAAGCGTTTACCCTT
Locus tag: PSHAa1770
Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
Locus tag: PSHAa1769
Name: galK Funciton: Galactokinase (EC 2.7.1.6)
Locus tag: PSHAa1768
Name: galP Funciton: Predicted sodium-dependent galactose transporter
Locus tag: PSHAa1767
Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3) |
||||
galT-galK-galP-galM | -54 | 6.3 | CGGGGTAAGCGTTTACCCTT | PSHAa1770 |