Orthologous regulated operons containing malE gene
| Regulog: | MalR1 - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium novyi NT | ||||
|
Position: -75
Score: 6.10862 Sequence: TACCAGTAACGTTTCCAAAA
Locus tag: NT01CX_0963
Name: malR1 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
Locus tag: NT01CX_0964
Name: malK Funciton: Maltose/maltodextrin transporter, ATP-binding protein
Locus tag: NT01CX_0965
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: NT01CX_0966
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: NT01CX_0967
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: NT01CX_0968
Name: malZ Funciton: Alpha-glucosidase (EC 3.2.1.20)
Locus tag: NT01CX_0969
Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: NT01CX_0970
Name: glgP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1) |
||||
| malR1-malK-malE-malF-malG-malZ-malQ-glgP | -75 | 6.1 | TACCAGTAACGTTTCCAAAA | NT01CX_0963 |