Orthologous regulated operons containing malK gene

Properties
Regulog:	MalR1 - Clostridia-1
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Clostridium novyi NT
Position: -75 Score: 6.10862 Sequence: TACCAGTAACGTTTCCAAAA Locus tag: NT01CX_0963 Name: malR1 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family Locus tag: NT01CX_0964 Name: malK Funciton: Maltose/maltodextrin transporter, ATP-binding protein Locus tag: NT01CX_0965 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: NT01CX_0966 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: NT01CX_0967 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: NT01CX_0968 Name: malZ Funciton: Alpha-glucosidase (EC 3.2.1.20) Locus tag: NT01CX_0969 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: NT01CX_0970 Name: glgP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malR1-malK-malE-malF-malG-malZ-malQ-glgP	-75	6.1	TACCAGTAACGTTTCCAAAA	NT01CX_0963

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --