Orthologous regulated operons containing SCO5692 gene
| Regulog: | SCO5692 - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -125
Score: 6.59019 Sequence: TTGTCGAAGCGCTTCGACAG
Locus tag: SAV_2569
Name: SCO5692 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
| SCO5692 | -125 | 6.6 | TTGTCGAAGCGCTTCGACAG | SAV_2569 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -124
Score: 6.86448 Sequence: GAGTCGAAGCGCTTCGACGG
Locus tag: SCO5692
Name: SCO5692 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
| SCO5692 | -124 | 6.9 | GAGTCGAAGCGCTTCGACGG | SCO5692 |
| Streptomyces scabiei 87.22 | ||||
|
Position: -125
Score: 6.3048 Sequence: TGATCGAAGCGCTTCGACAA
Locus tag: SCAB_25511
Name: SCO5692 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
| SCO5692 | -125 | 6.3 | TGATCGAAGCGCTTCGACAA | SCAB_25511 |