Orthologous regulated operons containing lamA gene
| Regulog: | BglR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Glaciecola sp. HTCC2999 | ||||
|
Position: -72
Score: 6.18095 Sequence: CAATGAAAGCGCTTTCATTT
Locus tag: GHTCC_010100001604
Name: glcP Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster
Locus tag: GHTCC_010100001599
Name: bglA2 Funciton: Periplasmic beta-glucosidase (EC 3.2.1.21)
Locus tag: GHTCC_010100001594
Name: lamA Funciton: Predicted glucose transporter in beta-glucoside utilization gene cluster |
||||
| glcP-bglA2-lamA | -72 | 6.2 | CAATGAAAGCGCTTTCATTT | GHTCC_010100001604 |