Orthologous regulated operons containing uraA gene
| Regulog: | HpxR - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xanthine utilization |
| Effector: | Xanthine |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cupriavidus taiwanensis | ||||
|
Position: -203
Score: 6.92778 Sequence: TTACCAAAACGTTTTTGTTA
Locus tag: RALTA_B0719
Name: uraA Funciton: Xanthine/uracil permease
Locus tag: RALTA_B0720
Name: COG0402 Funciton: Cytosine deaminase and related metal-dependent hydrolases
Locus tag: RALTA_B0721
Name: PF01925 Funciton: Protein of unknown function DUF81 |
||||
| uraA-COG0402-PF01925 | -203 | 6.9 | TTACCAAAACGTTTTTGTTA | RALTA_B0719 |
| Ralstonia eutropha H16 | ||||
|
Position: -119
Score: 6.66994 Sequence: TTACCAAAACGTTTTTGTTT
Locus tag: H16_B0861
Name: uraA Funciton: Xanthine/uracil permease
Locus tag: H16_B0862
Name: COG0402 Funciton: Cytosine deaminase and related metal-dependent hydrolases
Locus tag: H16_B0863
Name: PF01925 Funciton: Protein of unknown function DUF81 |
||||
| uraA-COG0402-PF01925 | -119 | 6.7 | TTACCAAAACGTTTTTGTTT | H16_B0861 |
| Ralstonia eutropha JMP134 | ||||
|
Position: -119
Score: 6.90087 Sequence: TAACCAAAACGTTTTGGCTA
Locus tag: Reut_B4531
Name: uraA Funciton: Xanthine/uracil permease
Locus tag: Reut_B4530
Name: COG0402 Funciton: Cytosine deaminase and related metal-dependent hydrolases
Locus tag: Reut_B4529
Name: PF01925 Funciton: Protein of unknown function DUF81 |
||||
| uraA-COG0402-PF01925 | -119 | 6.9 | TAACCAAAACGTTTTGGCTA | Reut_B4531 |