Orthologous regulated operons containing SCO2750 gene
| Regulog: | SCO2753 - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | New effector |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -72
Score: 6.59482 Sequence: CATAGAAAGCGCTTGCTGCG
Locus tag: SAV_5313
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: SAV_5314
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: SAV_5315
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -72 | 6.6 | CATAGAAAGCGCTTGCTGCG | SAV_5313 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -87
Score: 6.52863 Sequence: CATAGAAAGCGCTTGCTGTA
Locus tag: SCO2752
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: SCO2751
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: SCO2750
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -87 | 6.5 | CATAGAAAGCGCTTGCTGTA | SCO2752 |
| Streptomyces griseus subsp. griseus NBRC 13350 | ||||
|
Position: -39
Score: 6.53179 Sequence: GATAGAAAGCGCTTGCTACG
Locus tag: SGR_4813
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: SGR_4814
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: SGR_4815
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -39 | 6.5 | GATAGAAAGCGCTTGCTACG | SGR_4813 |
| Streptomyces scabiei 87.22 | ||||
|
Position: -98
Score: 6.6257 Sequence: GATAGAAAGCGCTTGCTGTG
Locus tag: SCAB_58381
Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase
Locus tag: SCAB_58391
Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization
Locus tag: SCAB_58401
Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase |
||||
| SCO2752-SCO2751-SCO2750 | -98 | 6.6 | GATAGAAAGCGCTTGCTGTG | SCAB_58381 |