Orthologous regulated operons containing PFL_0254 gene
| Regulog: | PFL_0254 - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azotobacter vinelandii AvOP | ||||
|
Position: -168
Score: 6.06161 Sequence: TTATGTCAGCGCTAACATGC
Locus tag: Avin_21780
Name: PFL_0254 Funciton: Transcriptional regulator, LacI family |
||||
| PFL_0254 | -168 | 6.1 | TTATGTCAGCGCTAACATGC | Avin_21780 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -105
Score: 6.83937 Sequence: CTTTGTTAGCGCTAACATCG
Locus tag: PFL_0254
Name: PFL_0254 Funciton: Transcriptional regulator, LacI family |
||||
| PFL_0254 | -105 | 6.8 | CTTTGTTAGCGCTAACATCG | PFL_0254 |
| Pseudomonas syringae pv. tomato str. DC3000 | ||||
|
Position: -106
Score: 6.90825 Sequence: CGTTGTTAGCGCTAACATCG
Locus tag: PSPTO0347
Name: PFL_0254 Funciton: Transcriptional regulator, LacI family |
||||
| PFL_0254 | -106 | 6.9 | CGTTGTTAGCGCTAACATCG | PSPTO0347 |