Orthologous regulated operons containing bglR gene
| Regulog: | BglR - Listeriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Listeria innocua Clip11262 | ||||
|
Position: -290
Score: 6.74215 Sequence: TCATAGAAACGTTTCGACAA
Locus tag: lin1840
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: lin1839
Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-)
Locus tag: lin1838
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family |
||||
| bglX-cbpA-bglR | -290 | 6.7 | TCATAGAAACGTTTCGACAA | lin1840 |
| Listeria monocytogenes EGD-e | ||||
|
Position: -289
Score: 6.74215 Sequence: TCATAGAAACGTTTCGACAA
Locus tag: lmo1729
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: lmo1728
Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-)
Locus tag: lmo1727
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family |
||||
| bglX-cbpA-bglR | -289 | 6.7 | TCATAGAAACGTTTCGACAA | lmo1729 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | ||||
|
Position: -289
Score: 6.52852 Sequence: CTATAGAAACGTTTCGACAA
Locus tag: lse_1700
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: lse_1699
Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-)
Locus tag: lse_1698
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family |
||||
| bglX-cbpA-bglR | -289 | 6.5 | CTATAGAAACGTTTCGACAA | lse_1700 |
| Listeria welshimeri serovar 6b str. SLCC5334 | ||||
|
Position: -290
Score: 6.74215 Sequence: TCATAGAAACGTTTCGACAA
Locus tag: lwe1746
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: lwe1745
Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-)
Locus tag: lwe1744
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family |
||||
| bglX-cbpA-bglR | -290 | 6.7 | TCATAGAAACGTTTCGACAA | lwe1746 |